Genetic reporter analysis reveals an expandable reservoir of OCT4+ cells in adult skin

  • Anne Limbourg1, 2, 3, 4,

    Affiliated with

    • Sabine Schnabel1, 2,

      Affiliated with

      • Vladimir J Lozanovski1, 2, 10,

        Affiliated with

        • L Christian Napp1, 5,

          Affiliated with

          • Teng-Cheong Ha2, 6,

            Affiliated with

            • Tobias Maetzig2, 6,

              Affiliated with

              • Johann Bauersachs2, 5,

                Affiliated with

                • Hassan Y Naim7,

                  Affiliated with

                  • Axel Schambach2, 3, 6, 8Email author and

                    Affiliated with

                    • Florian P Limbourg1, 2, 9, 11Email author

                      Affiliated with

                      Contributed equally
                      Cell Regeneration20143:9

                      DOI: 10.1186/2045-9769-3-9

                      Received: 4 December 2013

                      Accepted: 3 June 2014

                      Published: 14 June 2014

                      Abstract

                      The transcription factor Oct4 (Pou5f1) is a critical regulator of pluripotency in embryonic and induced pluripotent stem cells. Therefore, Oct4 expression might identify somatic stem cell populations with inherent multipotent potential or a propensity for facilitated reprogramming. However, analysis of Oct4 expression is confounded by Oct4 pseudogenes or non-pluripotency-related isoforms. Systematic analysis of a transgenic Oct4-EGFP reporter mouse identified testis and skin as two principle sources of Oct4+ cells in postnatal mice. While the prevalence of GFP+ cells in testis rapidly declined with age, the skin-resident GFP+ population expanded in a cyclical fashion. These cells were identified as epidermal stem cells dwelling in the stem cell niche of the hair follicle, which endogenously expressed all principle reprogramming factors at low levels. Interestingly, skin wounding or non-traumatic hair removal robustly expanded the GFP+ epidermal cell pool not only locally, but also in uninjured skin areas, demonstrating the existence of a systemic response. Thus, the epithelial stem cell niche of the hair follicle harbors an expandable pool of Oct4+ stem cells, which might be useful for therapeutic cell transfer or facilitated reprogramming.

                      Keywords

                      Oct4 Epidermal stem cells Skin Transgenic reporter mice

                      Background

                      Regenerative cell therapy for terminally differentiated organs damaged by disease requires multipotent stem cell reservoirs, preferably from autologous sources. The POU-domain transcription factor Oct4 (Pou5f1) is an important regulator of pluripotency in embryonic stem (ES) and induced pluripotent stem (iPS) cells [1]. The latter arise during re-programming from clones re-expressing endogenous Oct4 [2], while under specific culture conditions ectopic expression of Oct4 alone in primary somatic cells is sufficient for reprogramming into iPS or multilineage progenitors [3, 4]. Therefore, endogenous Oct4+ stem cells might either display inherent multipotent differentiation potential or serve as a source for minimal modification approaches to generate iPS with high efficiency. However, analysis of Oct4 expression is confounded by false-positive results due to Oct4 pseudogenes or non-pluripotency-related, non-nuclear OCT4B isoforms, explaining contradictory reports on Oct4 expression in several somatic stem cell populations [5].

                      The hair follicle, as part of the protective and self-renewing mammalian epidermis, is one of the few organs that undergoes constant cycles of degeneration and regeneration throughout life. It contains an epidermal stem cell niche harboring multipotent epidermal stem cells, which can be mobilized to regenerate the new follicle with each hair cycle or in damaged skin during wound repair [6]. Multipotent epidermal stem cells not only give rise to new epidermis and hair when grafted but are able to correct inherited skin disease in humans and differentiate into all principle tissue lineages in culture [69], while a population of skin stem cells can contribute to skeletal muscle fiber regeneration in muscle dystrophy after cell transplantation [10]. Furthermore, a poorly characterized subset of cells isolated from human hair follicles has been shown to express Oct4 and to display multipotent behavior in vitro [11]. Our objective was to identify adult somatic stem cells expressing Oct4 using a well characterized Oct4-GFP genetic reporter mouse model as a potential reservoir for regenerative cell therapy.

                      Results

                      To identify in a genetic screening approach OCT4+ stem cells during postnatal life, we analyzed different tissues of Pou5f1-EGFP transgenic reporter mice (called OG2) for GFP expression by flow cytometry. These mice express enhanced GFP under the control of the Oct4 promoter including the distal enhancer, and expression of GFP has been shown to serve as well described reporter for endogenous, pluripotency-related OCT4 expression in induced pluripotent stem cells as well as during development and more interestingly postnatal life [1215].

                      We verified the fidelity of the reporter by analyzing postnatal testis, since a subset of male spermatogonial stem cells (SSC) have been shown to express OCT4 and can give rise to pluripotent stem cells [12, 1618]. FACS analysis of newborn mouse testis revealed a distinct cell population with specific GFP-fluorescence expressing OCT4 (Figure 1A, Additional file 1: Figure S1, Table 1). However, the prevalence of GFP+ cells in testis was highest in the early postnatal period but rapidly declined to permanently low levels with maturation ( ≥3-4 wks, Figure1B).
                      http://static-content.springer.com/image/art%3A10.1186%2F2045-9769-3-9/MediaObjects/13619_2013_Article_25_Fig1_HTML.jpg
                      Figure 1

                      Characterization of GFP + cell populations in testis and skin in Oct4-Gfp (OG2) reporter mice. (A) Flow cytometry of cell suspensions from 1 wk old neonatal testis with compensation for autofluorescence by plotting FL1 against FL2. Dead cells are stained with propidium iodide (PI). (B) Timecourse analysis by flow cytometry of GFP + cells in testis at 0–2 wks, 3–4 wks, 6 wks and 24 wks of age. P vs 0–2 wks. (C) Representative FACS analysis and GFP+ gating of cell suspensions from skin. (D) Fluorescence microscopy of sorted GFP+ and GFP- cells for GFP, anti-OCT4 antibody staining (red) and nuclear dye (DAPI, blue). (E) GFP+ skin cells by FACS in different age groups (left), n = 36-45. Cyclic expansion of the GFP+ cell pool over time (right). n = 9-30. P vs 0.5 wks. (F) Immunostaining of hair follicle bulge region against smooth muscle α–actin (SMA) and GFP. Insert from same image in higher magnification. (G) Flow cytometry of GFP+ or GFP- gated cells from skin. CD34+ ITGα6hi and CD34+ ITGα6lo populations are indicated. (H) Representative flow cytometry profile of GFP+ gated cells stained with specific antibodies (spec. ab) or isotype control (isotype). (I) mRNA expression (2ΔCt) by quantitative real-time PCR of pluripotency factors from sorted skin cells or cultures of iPS and ES cells. n = 3-4. Scale bar: 20 um. Magnification: (D) 640, (F) 200, 640 (insert).

                      Table 1

                      Frequency of GFP + cells in different mouse tissues and age groups

                      Organ

                      Age

                      GFP+/500.000 cells

                      Analyzed cells/mouse

                        

                      mean

                      SD

                      n

                      mean

                      Heart

                      Infant

                      0

                      0

                      12

                      3.58E + 06

                       

                      Puberty

                      0

                      0

                      15

                      2.83E + 07

                       

                      Adult

                      0

                      0

                      14

                      2.46E + 07

                      Heart p MI

                      12 wks

                      0

                      0

                      8

                      2.67E + 07

                      Bone marrow

                      Infant

                      0

                      0

                      11

                      2.49E + 07

                       

                      Puberty

                      0

                      0

                      14

                      4.22E + 07

                       

                      Adult

                      0

                      0

                      10

                      5.87E + 07

                      Spleen

                      Infant

                      0

                      0

                      14

                      2.83E + 07

                       

                      Puberty

                      0

                      0

                      10

                      8.97E + 07

                       

                      Adult

                      0

                      0

                      9

                      7.03E + 07

                      Testis

                      Infant

                      2791

                      1229

                      9

                      1.22E + 06

                       

                      Puberty

                      110

                      77

                      11

                      3.00E + 07

                       

                      Adult

                      27

                      20

                      15

                      1.52E + 07

                      Skin

                      Infant

                      50

                      39

                      25

                      8.30E + 06

                       

                      Puberty

                      396

                      245

                      23

                      6.35E + 06

                       

                      Adult

                      31

                      25

                      31

                      7.57E + 06

                      Infant: 1–2 wks, puberty: 3–4 wks, adult: 6 wks, hearts p MI (post myocardial infarction) were harvested between d3 and d7.

                      Screening of various tissues reported to harbor Oct4 expressing stem cells, such as heart and bone marrow, did not detect GFP+ cells in these tissues, although large cell numbers from each organ were analyzed (Table 1). As Oct4 expression was also found in human adipose tissue derived stem cells [19], we also analyzed GFP expression in the inguinal adipose tissue, but could not detect GFP+ cells in 4 analyzed animals (data not shown). However, GFP+ cells were discovered in the skin (Table 1, Figure 1C), which express the nuclear, pluripotency-related OCT4 isoform (Figure 1D). This cell population expanded transiently and in a biphasic fashion during postnatal life, peaking at puberty and early adulthood, which was reminiscent of the synchronized and cyclic activity of the hair follicle during the first hair cycles (Figure 1E). In situ, GFP+ cells localized to the bulge region of the hair follicle, which is a niche for multipotent epithelial stem cells and marked by the insertion of smooth muscle cells (Figure 1F) [6]. These multipotent stem cells consist of a basal and suprabasal population, which behave analogously with respect to self-renewal and differentiation potential, and which are defined by expression of CD34 and high or low expression of integrin (ITG) α6, respectively [6]. Flow cytometry of GFP+ and GFP- skin cells revealed that GFP+ cells were found in both stem cell subsets, but not in the non-stem cell compartment (Figure 1G). These data suggest that GFP expression identifies an Oct4 + population of multipotent epidermal stem cells residing in the stem cell niche of the hair follicle. Further characterization of the surface marker profile of GFP+ stem cells revealed a phenotype of Sca-1+, CD117lo, CXCR4lo and ITG β1- (Figure 1H). In contrast to GFP- cells, GFP + cells also showed evidence for Oct4 mRNA expression, as demonstrated by primers specific for exon 1, but expression levels were considerably lower than in ES or iPS controls. Interestingly, GFP+ cells also expressed low amounts of other key iPS reprogramming factors, Klf4, Sox2 and c-Myc, however, these were also present in GFP- cells (Figure 1I).

                      The cyclic and synchronized expansion of GFP+ skin cells observed during postnatal maturation suggested regulation by external cues. To test this hypothesis we analyzed the behavior of GFP + cells following dorsal skin wounding by punch biopsy in adult mice. Follwing wounding, there was a rapid and transient increase in GFP+ cells in dorsal skin. However, this response was not limited to areas of injury, but also occurred in remote dorsal skin areas, and even in abdominal skin (Figure 2A). This suggests a systemic signal controlling GFP+ cell expansion in response to injury. Furthermore, non-traumatic hair removal by depilation, which stimulates the hair follicle without skin injury, induced a comparable expansion of stem cells throughout the skin (Figure 2B, and data not shown). Following depilation, GFP+ cells were also detected outside the bulge region along the structures provided by smooth muscle cells, suggesting mobilization (Figure 2C).
                      http://static-content.springer.com/image/art%3A10.1186%2F2045-9769-3-9/MediaObjects/13619_2013_Article_25_Fig2_HTML.jpg
                      Figure 2

                      Dynamic expansion of GFP + cells in skin. (A) Localized punch injury to dorsal skin. Left, FACS count of GFP+ cells from dorsal (dors) and abdominal (abd) skin. n = 14-28. P vs. same side basal (0). Right, box blot of epidermal GFP+ cells from wound area (W) vs remote (R) dorsal skin at d3. n = 13. (B) Box plot of epidermal GFP+ cells by FACS after non-traumatic skin depilation, age 12–14 wks, n = 9-28. P vs. basal (d0). (C) Immunostaining against smooth muscle–actin (red) and GFP (green) in flank skin after dorsal depilation, DAPI (blue). Scale bar: 20 um, magnification: 400 (upper panel), 640 (lower panel). GFP- gated cells from skin. CD34+ ITGα6hi and CD34+ ITGα6lo populations are indicated. (H).

                      Discussion

                      Using an Oct4-GFP transgenic reporter, we identify skin as a novel principle source of postnatal Oct4+ cells. We also confirm previous reports on the existence of OCT4+ cells in neonatal testis [12, 1618]. However, numbers of GFP+ cells in testis decline rapidly and permanently before puberty. In contrast, the skin-resident cell pool expands postnatally in a cyclic fashion strikingly matching the time-course of the cyclic hair follicle activity during the first postnatal hair cycles, which in the mouse occurs in a synchronized fashion [20]. In situ, GFP + cells localize into the bulge region of the hair follicle, which constitutes a niche for two populations of multipotent epidermal stem cells. Surface marker analysis demonstrates that GPF + cells are present in both stem cell subsets. Furthermore, the adult GFP + stem cell pool expands in the entire skin in response to injury or non-traumatic depilation, suggesting so far unknown systemic signals controlling stem cell expansion. This also establishes a simple but defined setting for cell expansion for therapeutic cell harvest, i.e. depilation. The here characterized Oct4 + epidermal stem cells not only express the nuclear OCT4 isoform but – albeit at very low levels – other factors of the reprogramming cocktail. Notably, epidermal stem cell populations with similar characteristics also exist in humans [11, 21]. Thus, skin might serve as a reservoir for an expandable stem cell population, which could be useful for therapeutic cell transfer or facilitated reprogramming to generate iPS ex vivo.

                      The functional relevance of Oct4 expression, and the biological potential of the identified cell population, requires further studies. Mice with conditional-inducible deletion of Oct4 in skin cells using the keratin K15 promoter showed normal hair follicle architecture and skin wound healing response in short-term experiments [22]. However, the long-term consequences of Oct4 deletion were not studied. Furthermore, multipotent epidermal stem cells in the hair follicle bulge have been identified and characterized based on K14 expression [6], leaving open the possibility of an escape from Oct4 inactivation in this study.

                      Of note, Dyce and colleagues have differentiated skin-derived stem cells into oocyte-like cells, i.e. Oct4high germ cells [23]. In light of our findings and recent reports that culture conditions strongly influence cell fate control, e.g. as for gPS, one could envision that Oct4+ skin cells have been reprogrammed under appropriate culture conditions into Oct4high germ cells, e.g. oocyte-like cells.

                      Importantly, just recently human multipotent dermal stem cells have been isolated based on neural crest stem cell marker nestin [24]. Importantly, these cells were also positive for Oct4, suggesting that Oct4 positivity of dermal stem cells might be conserved across species.

                      Conclusions

                      Our findings of an expandable Oct4+ stem cell pool in the skin may have implications for facilitated reprogramming or for the development of new skin stem cell-based therapeutic models. In addition, if it is possible to culture Oct4+ epithelial stem cells in vitro, this will also ease genetic modification of skin stem cells to repair genetic defects, e.g. for gene therapy of epidermolysis bullosa.

                      Methods

                      Antibodies

                      Rabbit anti-Oct4 sc-9081 (Santa Cruz), mouse anti-SMA-Cy3 C6198 (Sigma), rabbit anti-GFP SP3005P (Acris), rat anti-c-kit/CD117 clone 3C1 (Miltenyi Biotec), rat anti-Cxcr4 FAB21651A (R&D Systems), rat anti-sca-1 clone D7 (Miltenyi Biotec), rat anti-α6-Integrin clone GH3 (R&D Systems), rat anti-CD34, clone MEC14.7 (Biolegend).

                      Primers

                      RT-PCR: Oct4, fwd: gcgttctctttggaaaggt, rev: agcctcatactcttctcgttgg. Rex-1, fwd: caccatccgggatgaaagtgagat, rev: accagaaaatgtcgctttagtttc. GAPDH: fwd: accacagtccatgccatcac, rev: tccaccaccctgttgctgta. Real-time PCR: Oct4, fwd: gttggagaaggtggaaccaa, rev: ctccttctgcagggctttc. Myc, fwd: cgcctagaattggcagaaat, rev: aactgagaagaatcctattcagcac. Klf4, fwd: cgggaagggagaagacact, rev: gagttcctcacgccaacg. Sox2, fwd: tgctgcctctttaagactaggg, rev: tcgggctccaaacttctct. Quantitative real-time PCR was carried out on the LightCycler 480 System (Roche).

                      Mice

                      The study was conducted with permission of the State of Niedersachsen, conforming to the German Law for the Protection of Animals and the NIH Guide for the Care and Use of Laboratory Animals. Pou5f1-egfp reporter mice (B6; CBA-Tg (Pou5f1-EGFP) 2Mnn), have been described before and were housed at SPF conditions [12].

                      Cell isolation and FACS analysis

                      Tissues were dispersed mechanically or digested with Collagenase I (0.25% w/v) and DNAse I (360 U/ml) for 45 min at 37 C. For isolation of skin-resident cells, mice were shaved thoroughly and abdominal, dorsal and flank skin carefully excised. Whole skin was spanned with the epidermis facing down and dermal fat mechanically removed using curved tweezers. Skin was washed in PBS, finely homogenized using surgical scalpels and digested. The released cells where recovered by centrifugation, washed several times with PBS with 2% FCS, stained with propium iodide solution and analyzed on a FACSCalibur (BD Bioscience). Specific GFP-fluorescence was discriminated from autofluorescence and dead cells by plotting FL-1 vs FL-2 with uncompensated settings.

                      Statistics

                      Data are given as mean and SEM, unless stated otherwise. Comparisons were performed by Student’s t-test or ANOVA with Bonferroni’s or Dunnett’s post-test.

                      Abbreviations

                      ES: 

                      Embryonic stem cell

                      iPS: 

                      Induced pluripotent stem cells

                      K14: 

                      Cytokeratin-14

                      K15: 

                      Cytokeratin-15

                      FACS: 

                      Fluorescent activated cell sorter

                      SD: 

                      Standard deviation

                      SPF: 

                      Specific pathogen free

                      GFP: 

                      Green fluorescent protein

                      FL: 

                      Fluorescence

                      ITG: 

                      Integrin

                      PBS: 

                      Phosphate-buffered saline

                      FCS: 

                      Fetal calf serum

                      gPS: 

                      Germline-derived pluripotent stem cells.

                      Declarations

                      Acknowledgements

                      We thank T. Cantz and H. R. Schöler (Hannover/Muenster, Germany) for providing OG2 mice and ES cell cultures and valuable advice. This work is supported by funding from the Deutsche Forschungsgemeinschaft (REBIRTH EXC 62/1, SFB738), the BMBF (IFB-Tx 01EO0802), DEBRA, E-RARE and the DAAD (scholarship and German-Chinese research group).

                      Authors’ Affiliations

                      (1)
                      Research Group Regenerative Agents
                      (2)
                      REBIRTH Cluster of Excellence
                      (3)
                      Integrated Research Center Transplantation (IFB-Tx)
                      (4)
                      Department of Plastic, Hand and Reconstructive Surgery
                      (5)
                      Department of Cardiology and Angiology
                      (6)
                      Institute of Experimental Hematology, OE6960 Hannover Medical School
                      (7)
                      Department of Physiological Chemistry, Hannover Veterinary School
                      (8)
                      Division of Hematology/Oncology, Boston Children’s Hospital, Harvard Medical School
                      (9)
                      Department of Nephrology and Hypertension, Hannover Medical School
                      (10)
                      Department of General and Transplant Surgery, University Hospital Heidelberg
                      (11)
                      Vascular Medicine and Transplantation Research, Dept. of Nephrology and Hypertension, OE 6841 Hannover Medical School

                      References

                      1. Tada T: Genetic modification-free reprogramming to induced pluripotent cells: fantasy or reality? Cell Stem Cell 2008, 3: 121–122. 10.1016/j.stem.2008.07.005PubMedView Article
                      2. Wernig M, Meissner A, Foreman R, Brambrink T, Ku M, Hochedlinger K, Bernstein BE, Jaenisch R: In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 2007, 448: 318–324. 10.1038/nature05944PubMedView Article
                      3. Zhu S, Li W, Zhou H, Wei W, Ambasudhan R, Lin T, Kim J, Zhang K, Ding S: Reprogramming of human primary somatic cells by OCT4 and chemical compounds. Cell Stem Cell 2010, 7: 651–655. 10.1016/j.stem.2010.11.015PubMedView Article
                      4. Tsai SY, Bouwman BA, Ang YS, Kim SJ, Lee DF, Lemischka IR, Rendl M: Single transcription factor reprogramming of hair follicle dermal papilla cells to induced pluripotent stem cells. Stem Cells 2011, 29: 964–971. 10.1002/stem.649PubMedView Article
                      5. Liedtke S, Enczmann J, Waclawczyk S, Wernet P, Kögler G: Oct4 and its pseudogenes confuse stem cell research. Cell Stem Cell 2007, 1: 364–366. 10.1016/j.stem.2007.09.003PubMedView Article
                      6. Blanpain C, Lowry WE, Geoghegan A, Polak L, Fuchs E: Self-renewal, multipotency, and the existence of two cell populations within an epithelial stem cell niche. Cell 2004, 118: 635–648. 10.1016/j.cell.2004.08.012PubMedView Article
                      7. Fernandes KJ, McKenzie IA, Mill P, Smith KM, Akhavan M, Barnabe-Heider F, Biernaskie J, Junek A, Kobayashi NR, Toma JG, Kaplan DR, Labosky PA, Rafuse V, Hui CC, Miller FD: A dermal niche for multipotent adult skin-derived precursor cells. Nat Cell Biol 2004, 6: 1082–1093. 10.1038/ncb1181PubMedView Article
                      8. Toma JG, Akhavan M, Fernandes KJ, Barnabe-Heider F, Sadikot A, Kaplan DR, Miller FD: Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 2001, 3: 778–784. 10.1038/ncb0901-778PubMedView Article
                      9. Mavilio F, Pellegrini G, Ferrari S, Di Nunzio F, Di Iorio E, Recchia A, Maruggi G, Ferrari G, Provasi E, Bonini C, Capurro S, Conti A, Magnoni C, Giannetti A, De Luca M: Correction of junctional epidermolysis bullosa by transplantation of genetically modified epidermal stem cells. Nat Med 2006, 12: 1397–1402.PubMedView Article
                      10. Montanaro F, Liadaki K, Volinski J, Flint A, Kunkel LM: Skeletal muscle engraftment potential of adult mouse skin side population cells. Proc Natl Acad Sci U S A 2003, 100: 9336–9341. 10.1073/pnas.1133179100PubMed CentralPubMedView Article
                      11. Yu H, Fang D, Kumar SM, Li L, Nguyen TK, Acs G, Herlyn M, Xu X: Isolation of a novel population of multipotent adult stem cells from human hair follicles. Am J Pathol 2006, 168: 1879–1888. 10.2353/ajpath.2006.051170PubMed CentralPubMedView Article
                      12. Szabo PE, Hubner K, Scholer H, Mann JR: Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev 2002, 115: 157–160. 10.1016/S0925-4773(02)00087-4PubMedView Article
                      13. Izadyar F, Pau F, Marh J, Slepko N, Wang T, Gonzalez R, Ramos T, Howerton K, Sayre C, Silva F: Generation of multipotent cell lines from a distinct population of male germ line stem cells. Reproduction 2008, 135: 771–784. 10.1530/REP-07-0479PubMedView Article
                      14. Yoshimizu T, Sugiyama N, De Felice M, Yeom YI, Ohbo K, Masuko K, Obinata M, Abe K, Schöler HR, Matsui Y: Germline-specific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice. Dev Growth Differ 1999, 41: 675–684. 10.1046/j.1440-169x.1999.00474.xPubMedView Article
                      15. Warlich E, Kuehle J, Cantz T, Brugman MH, Maetzig T, Galla M, Filipczyk AA, Halle S, Klump H, Scholer HR, Baum C, Schroeder T, Schambach A: Lentiviral vector design and imaging approaches to visualize the early stages of cellular reprogramming. Mol Ther: J of the Am Soc of Gene Ther 2011, 19: 782–789. 10.1038/mt.2010.314View Article
                      16. Guan K, Nayernia K, Maier LS, Wagner S, Dressel R, Lee JH, Nolte J, Wolf F, Li M, Engel W, Hasenfuss G: Pluripotency of spermatogonial stem cells from adult mouse testis. Nature 2006, 440: 1199–1203. 10.1038/nature04697PubMedView Article
                      17. Ko K, Arauzo-Bravo MJ, Kim J, Stehling M, Scholer HR: Conversion of adult mouse unipotent germline stem cells into pluripotent stem cells. Nat Protoc 2010, 5: 921–928. 10.1038/nprot.2010.44PubMedView Article
                      18. Ko K, Tapia N, Wu G, Kim JB, Bravo MJ, Sasse P, Glaser T, Ruau D, Han DW, Greber B, Hausdorfer K, Sebastiano V, Stehling M, Fleischmann BK, Brustle O, Zenke M, Scholer HR: Induction of pluripotency in adult unipotent germline stem cells. Cell Stem Cell 2009, 5: 87–96. 10.1016/j.stem.2009.05.025PubMedView Article
                      19. Watson JE, Patel NA, Carter G, Moor A, Patel R, Ghansah T, Mathur A, Murr MM, Bickford P, Gould LJ, Cooper DR: Comparison of markers and functional attributes of human adipose-derived stem cells and dedifferentiated adipocyte cells from subcutaneous fat of an obese diabetic donor. Advances in wound care 2014, 3: 219–228. 10.1089/wound.2013.0452PubMed CentralPubMedView Article
                      20. Lavker RM, Miller S, Wilson C, Cotsarelis G, Wei ZG, Yang JS, Sun TT: Hair follicle stem cells: their location, role in hair cycle, and involvement in skin tumor formation. J Invest Dermatol 1993, 101: 16S-26S. 10.1111/1523-1747.ep12362556PubMedView Article
                      21. Rochat A, Kobayashi K, Barrandon Y: Location of stem cells of human hair follicles by clonal analysis. Cell 1994, 76: 1063–1073. 10.1016/0092-8674(94)90383-2PubMedView Article
                      22. Lengner CJ, Camargo FD, Hochedlinger K, Welstead GG, Zaidi S, Gokhale S, Scholer HR, Tomilin A, Jaenisch R: Oct4 expression is not required for mouse somatic stem cell self-renewal. Cell Stem Cell 2007, 1: 403–415. 10.1016/j.stem.2007.07.020PubMed CentralPubMedView Article
                      23. Dyce PW, Liu J, Tayade C, Kidder GM, Betts DH, Li J: In vitro and in vivo germ line potential of stem cells derived from newborn mouse skin. PLoS One 2011, 6: e20339. 10.1371/journal.pone.0020339PubMed CentralPubMedView Article
                      24. Li L, Fukunaga-Kalabis M, Herlyn M: Isolation, characterization, and differentiation of human multipotent dermal stem cells. Methods Mol Biol 2013, 989: 235–246. 10.1007/978-1-62703-330-5_18PubMedView Article

                      Copyright

                      © Limbourg et al.; licensee BioMed Central Ltd. 2014

                      This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

                      Advertisement