Skip to main content

Advertisement

Table 1 Primer sequences used in qRT-PCR

From: A feeder-free, human plasma-derived hydrogel for maintenance of a human embryonic stem cell phenotype in vitro

Target gene Accession No. Sense Primer Antisense Primer Tm (°C)
OCT4 NM002701.4 TGGCTCTGCTGACACATC TGGTTCGCTTTCTCTTTCG 53.4
SOX2 NM003106.2 GAGAGAAAGAAAGGGAGAGAAG GAGAGAGGCAAACTGGAATC 53.0
NANOG NM024865.2 CTGGCTGAATCCTTCCTCTCC TGATTAGGCTCCAACCATACTCC 57.0
Β-Actin NM001101 GGACCTGACTGACTACCTC GCCATCTCTTGCTCGAAG 53.9